Transcript: Mouse NM_001347221.1

Mus musculus lysine (K)-specific demethylase 1A (Kdm1a), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Kdm1a (99982)
Length:
3075
CDS:
139..2760

Additional Resources:

NCBI RefSeq record:
NM_001347221.1
NBCI Gene record:
Kdm1a (99982)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001347221.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071373 CGGCATCTACAAGAGGATAAA pLKO.1 993 CDS 100% 13.200 10.560 N Kdm1a n/a
2 TRCN0000351788 CGGCATCTACAAGAGGATAAA pLKO_005 993 CDS 100% 13.200 10.560 N Kdm1a n/a
3 TRCN0000071374 CCAAGGTAGAATACAGAGAAA pLKO.1 488 CDS 100% 4.950 3.960 N Kdm1a n/a
4 TRCN0000351704 CCAAGGTAGAATACAGAGAAA pLKO_005 488 CDS 100% 4.950 3.960 N Kdm1a n/a
5 TRCN0000071375 CCACAAGTCAAACCTTTATTT pLKO.1 2027 CDS 100% 15.000 10.500 N Kdm1a n/a
6 TRCN0000351790 CCACAAGTCAAACCTTTATTT pLKO_005 2027 CDS 100% 15.000 10.500 N Kdm1a n/a
7 TRCN0000071376 GCTGAAGGCTTGGACATTAAA pLKO.1 1936 CDS 100% 15.000 10.500 N Kdm1a n/a
8 TRCN0000071377 GAGTTGAAAGAGCTTCTTAAT pLKO.1 1519 CDS 100% 13.200 9.240 N Kdm1a n/a
9 TRCN0000351789 GAGTTGAAAGAGCTTCTTAAT pLKO_005 1519 CDS 100% 13.200 9.240 N Kdm1a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347221.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14075 pDONR223 100% 76.2% 83.2% None (many diffs) n/a
2 ccsbBroad304_14075 pLX_304 0% 76.2% 83.2% V5 (many diffs) n/a
Download CSV