Transcript: Mouse NM_001347451.1

Mus musculus anaphase promoting complex subunit 16 (Anapc16), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Anapc16 (52717)
Length:
1906
CDS:
199..588

Additional Resources:

NCBI RefSeq record:
NM_001347451.1
NBCI Gene record:
Anapc16 (52717)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001347451.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000172494 CAAGTGGCATCCACGCTTAAA pLKO.1 439 CDS 100% 13.200 18.480 N ANAPC16 n/a
2 TRCN0000250524 CAAGTGGCATCCACGCTTAAA pLKO_005 439 CDS 100% 13.200 18.480 N Anapc16 n/a
3 TRCN0000250525 GCCGACGAGTGGCGGTTTAAA pLKO_005 526 CDS 100% 5.000 7.000 N Anapc16 n/a
4 TRCN0000191371 CTTAAACAGGTGAAGCATGAT pLKO.1 454 CDS 100% 4.950 6.930 N Anapc16 n/a
5 TRCN0000250526 ACGGTCACAGCCCAAACATTT pLKO_005 1094 3UTR 100% 13.200 10.560 N Anapc16 n/a
6 TRCN0000189798 GTTTAAACCCATCGAGCAGCT pLKO.1 540 CDS 100% 2.160 1.728 N Anapc16 n/a
7 TRCN0000250528 TCCTCTGTGAGTCGGTGTTTA pLKO_005 413 CDS 100% 13.200 9.240 N Anapc16 n/a
8 TRCN0000250527 CTCTGTTCACCTACCCGAAAG pLKO_005 356 CDS 100% 6.000 4.200 N Anapc16 n/a
9 TRCN0000168433 GCTGGAGAGATGTTAGAAGAT pLKO.1 379 CDS 100% 4.950 3.465 N ANAPC16 n/a
10 TRCN0000189797 GATGTTAGAAGATGGCTCCGA pLKO.1 387 CDS 100% 0.660 0.462 N Anapc16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347451.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04737 pDONR223 100% 76.7% 85.2% None (many diffs) n/a
2 ccsbBroad304_04737 pLX_304 0% 76.7% 85.2% V5 (many diffs) n/a
3 TRCN0000478532 AGCCAATTATCCTGTTGTGTCCCG pLX_317 90.5% 76.7% 85.2% V5 (many diffs) n/a
Download CSV