Transcript: Mouse NM_001347556.1

Mus musculus predicted gene, 39115 (Gm39115), mRNA.

Source:
NCBI, updated 2016-12-09
Taxon:
Mus musculus (mouse)
Gene:
Gm39115 (105243089)
Length:
1141
CDS:
50..748

Additional Resources:

NCBI RefSeq record:
NM_001347556.1
NBCI Gene record:
Gm39115 (105243089)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001347556.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098463 GCTGCTGCAAGCCTGTGTGTT pLKO.1 147 CDS 100% 1.650 0.825 Y Krtap5-1 n/a
2 TRCN0000098464 GCTGCTGCAAGCCCTGCTGTT pLKO.1 441 CDS 100% 0.000 0.000 Y Krtap5-1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347556.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00915 pDONR223 100% 58.7% 53.1% None (many diffs) n/a
2 ccsbBroad304_00915 pLX_304 0% 58.7% 53.1% V5 (many diffs) n/a
3 TRCN0000473555 AATCGCAAATACTACCTAGATCGT pLX_317 94.8% 58.7% 53.1% V5 (many diffs) n/a
Download CSV