Transcript: Mouse NM_001347583.1

Mus musculus nischarin (Nisch), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Nisch (64652)
Length:
2780
CDS:
165..1715

Additional Resources:

NCBI RefSeq record:
NM_001347583.1
NBCI Gene record:
Nisch (64652)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001347583.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000446268 ACCATGAGTGGACGATCAAAC pLKO_005 289 CDS 100% 10.800 15.120 N Nisch n/a
2 TRCN0000173457 GAGATCGACGAATCTGTGAAA pLKO.1 1071 CDS 100% 4.950 6.930 N Nisch n/a
3 TRCN0000217796 CTGTCGCCTTAAGTATCTTAA pLKO.1 719 CDS 100% 13.200 10.560 N Nisch n/a
4 TRCN0000437396 GATAACCTGCAGCACCTATAC pLKO_005 1146 CDS 100% 10.800 8.640 N Nisch n/a
5 TRCN0000437725 AGACTTCACCTGTCGCCTTAA pLKO_005 710 CDS 100% 10.800 7.560 N Nisch n/a
6 TRCN0000173431 CGACGAATCTGTGAAACTGAT pLKO.1 1076 CDS 100% 4.950 3.465 N Nisch n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347583.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07768 pDONR223 100% 29% 30.5% None (many diffs) n/a
2 ccsbBroad304_07768 pLX_304 0% 29% 30.5% V5 (many diffs) n/a
3 TRCN0000476629 CCAAAACAGGGGTCACAGGAATCA pLX_317 8.3% 29% 30.5% V5 (many diffs) n/a
Download CSV