Transcript: Human NM_001347698.2

Homo sapiens CD5 molecule like (CD5L), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
CD5L (922)
Length:
1703
CDS:
108..1151

Additional Resources:

NCBI RefSeq record:
NM_001347698.2
NBCI Gene record:
CD5L (922)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001347698.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000057591 GAGCAAGAAGAAGTTTATGAT pLKO.1 426 CDS 100% 5.625 3.938 N CD5L n/a
2 TRCN0000057589 GCACAGGAACAGAAGATACAT pLKO.1 394 CDS 100% 5.625 3.938 N CD5L n/a
3 TRCN0000057592 CATTTGCACCAGACCTGGATT pLKO.1 137 CDS 100% 4.950 3.465 N CD5L n/a
4 TRCN0000057588 CCCTTTGACTTGAGACTAGTA pLKO.1 828 CDS 100% 0.000 0.000 N CD5L n/a
5 TRCN0000057590 CCTCCTTCAGAGACCGGAAAT pLKO.1 985 CDS 100% 10.800 6.480 N CD5L n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1459 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347698.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00247 pDONR223 100% 99.8% 99.7% None 1040delT;1041_1042insA n/a
2 ccsbBroad304_00247 pLX_304 0% 99.8% 99.7% V5 1040delT;1041_1042insA n/a
3 TRCN0000466853 CGACCTGGTTGGGCCCGGAAATCA pLX_317 31.3% 99.8% 99.7% V5 1040delT;1041_1042insA n/a
Download CSV