Transcript: Human NM_001347822.1

Homo sapiens oxoglutarate dehydrogenase like (OGDHL), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
OGDHL (55753)
Length:
3292
CDS:
300..2705

Additional Resources:

NCBI RefSeq record:
NM_001347822.1
NBCI Gene record:
OGDHL (55753)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001347822.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429225 CGCTTATCTGTAGATTCAAAG pLKO_005 3068 3UTR 100% 10.800 15.120 N OGDHL n/a
2 TRCN0000036733 TGCGCCTATCTTCCATGTGAA pLKO.1 1040 CDS 100% 4.950 6.930 N OGDHL n/a
3 TRCN0000433178 TACATCAGCCCACGCTTCATG pLKO_005 2532 CDS 100% 4.950 3.960 N OGDHL n/a
4 TRCN0000036732 CATCGACAAATCCAGCGAGAT pLKO.1 512 CDS 100% 4.050 3.240 N OGDHL n/a
5 TRCN0000428299 ACCCAGAGGCTGTGATATATG pLKO_005 1069 CDS 100% 13.200 9.240 N OGDHL n/a
6 TRCN0000426222 TGATCACAACCATTGATAAAC pLKO_005 127 5UTR 100% 13.200 9.240 N OGDHL n/a
7 TRCN0000429033 CAAGTCCAGCTTTGACCAAAT pLKO_005 2234 CDS 100% 10.800 7.560 N OGDHL n/a
8 TRCN0000420234 AGGACGTGTGTGCCTATGAAT pLKO_005 1725 CDS 100% 5.625 3.938 N OGDHL n/a
9 TRCN0000036730 GCACAAGAACATGGGCTACTA pLKO.1 2507 CDS 100% 4.950 3.465 N OGDHL n/a
10 TRCN0000036729 GCTGATTATCTTCACACCTAA pLKO.1 2189 CDS 100% 4.950 3.465 N OGDHL n/a
11 TRCN0000426732 ACATCACTCTGTCGCTGGTTG pLKO_005 727 CDS 100% 4.050 2.835 N OGDHL n/a
12 TRCN0000251612 CTTGATCACAACCATTGATAA pLKO_005 125 5UTR 100% 13.200 7.920 N Ogdhl n/a
13 TRCN0000420682 TGTTCTCTTCTGTGCTCTTAG pLKO_005 3092 3UTR 100% 10.800 6.480 N OGDHL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347822.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08578 pDONR223 100% 79.2% 79.1% None (many diffs) n/a
2 ccsbBroad304_08578 pLX_304 0% 79.2% 79.1% V5 (many diffs) n/a
3 TRCN0000473460 TGCAGGAATTATCTCCTTCGTCTG pLX_317 17.5% 79.2% 79.1% V5 (many diffs) n/a
Download CSV