Transcript: Human NM_001347913.1

Homo sapiens bone morphogenetic protein 4 (BMP4), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
BMP4 (652)
Length:
1944
CDS:
611..1648

Additional Resources:

NCBI RefSeq record:
NM_001347913.1
NBCI Gene record:
BMP4 (652)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001347913.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059143 CCCTGGTCAATTCTGTCAATT pLKO.1 1497 CDS 100% 13.200 18.480 N BMP4 n/a
2 TRCN0000059144 GCGACACTTCTGCAGATGTTT pLKO.1 596 5UTR 100% 5.625 7.875 N BMP4 n/a
3 TRCN0000059145 GCGAGCCATGCTAGTTTGATA pLKO.1 482 5UTR 100% 5.625 4.500 N BMP4 n/a
4 TRCN0000059146 CCACGAAGAACATCTGGAGAA pLKO.1 784 CDS 100% 4.050 3.240 N BMP4 n/a
5 TRCN0000371373 TCCTTGAGGATAGACAGATAT pLKO_005 1659 3UTR 100% 13.200 9.240 N BMP4 n/a
6 TRCN0000377722 AGGGCCAGCATGTCAGGATTA pLKO_005 1164 CDS 100% 10.800 7.560 N BMP4 n/a
7 TRCN0000377667 GGGAGAAGCAGCCAAACTATG pLKO_005 1098 CDS 100% 10.800 7.560 N BMP4 n/a
8 TRCN0000059147 GATGAGTATGATAAGGTGGTA pLKO.1 1580 CDS 100% 2.640 1.848 N BMP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347913.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05899 pDONR223 100% 84.4% 84.3% None 0_1ins189;266T>C n/a
2 ccsbBroad304_05899 pLX_304 0% 84.4% 84.3% V5 0_1ins189;266T>C n/a
3 TRCN0000466014 TCCGATCGTACTGATTTAATAAAT pLX_317 27.5% 84.4% 84.3% V5 0_1ins189;266T>C n/a
Download CSV