Transcript: Human NM_001347916.1

Homo sapiens bone morphogenetic protein 4 (BMP4), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
BMP4 (652)
Length:
2080
CDS:
558..1784

Additional Resources:

NCBI RefSeq record:
NM_001347916.1
NBCI Gene record:
BMP4 (652)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001347916.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059143 CCCTGGTCAATTCTGTCAATT pLKO.1 1633 CDS 100% 13.200 18.480 N BMP4 n/a
2 TRCN0000059144 GCGACACTTCTGCAGATGTTT pLKO.1 732 CDS 100% 5.625 7.875 N BMP4 n/a
3 TRCN0000059145 GCGAGCCATGCTAGTTTGATA pLKO.1 618 CDS 100% 5.625 4.500 N BMP4 n/a
4 TRCN0000059146 CCACGAAGAACATCTGGAGAA pLKO.1 920 CDS 100% 4.050 3.240 N BMP4 n/a
5 TRCN0000371373 TCCTTGAGGATAGACAGATAT pLKO_005 1795 3UTR 100% 13.200 9.240 N BMP4 n/a
6 TRCN0000377722 AGGGCCAGCATGTCAGGATTA pLKO_005 1300 CDS 100% 10.800 7.560 N BMP4 n/a
7 TRCN0000377667 GGGAGAAGCAGCCAAACTATG pLKO_005 1234 CDS 100% 10.800 7.560 N BMP4 n/a
8 TRCN0000025905 CCATGATTCCTGGTAACCGAA pLKO.1 556 5UTR 100% 2.640 1.848 N Bmp4 n/a
9 TRCN0000059147 GATGAGTATGATAAGGTGGTA pLKO.1 1716 CDS 100% 2.640 1.848 N BMP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347916.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05899 pDONR223 100% 99.9% 99.7% None 455T>C n/a
2 ccsbBroad304_05899 pLX_304 0% 99.9% 99.7% V5 455T>C n/a
3 TRCN0000466014 TCCGATCGTACTGATTTAATAAAT pLX_317 27.5% 99.9% 99.7% V5 455T>C n/a
Download CSV