Transcript: Human NM_001347990.1

Homo sapiens MAM domain containing 2 (MAMDC2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-02-26
Taxon:
Homo sapiens (human)
Gene:
MAMDC2 (256691)
Length:
3085
CDS:
618..2318

Additional Resources:

NCBI RefSeq record:
NM_001347990.1
NBCI Gene record:
MAMDC2 (256691)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001347990.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000355760 CACTACAGGCTTAGGGTATTA pLKO_005 1742 CDS 100% 13.200 18.480 N MAMDC2 n/a
2 TRCN0000355761 TCCGTTTGGTCTACCAGATAA pLKO_005 859 CDS 100% 13.200 18.480 N MAMDC2 n/a
3 TRCN0000006974 CCCAATGTGAACTGGTTTGTT pLKO.1 1173 CDS 100% 5.625 4.500 N MAMDC2 n/a
4 TRCN0000006973 GCCCTGGATGACATTACAATA pLKO.1 2070 CDS 100% 13.200 9.240 N MAMDC2 n/a
5 TRCN0000006975 GCCATTACATTTATGTGGATA pLKO.1 766 CDS 100% 4.950 3.465 N MAMDC2 n/a
6 TRCN0000006976 GCAAGCTGAAATCACCTTTAA pLKO.1 1982 CDS 100% 13.200 7.920 N MAMDC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347990.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13476 pDONR223 100% 15.6% 13.8% None (many diffs) n/a
2 ccsbBroad304_13476 pLX_304 0% 15.6% 13.8% V5 (many diffs) n/a
3 TRCN0000469617 ACGTTGTCTGCGCGAAAAAGGCGG pLX_317 48.7% 15.6% 13.8% V5 (many diffs) n/a
Download CSV