Transcript: Human NM_001347994.1

Homo sapiens NACHT and WD repeat domain containing 1 (NWD1), transcript variant 3, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
NWD1 (284434)
Length:
7419
CDS:
692..4768

Additional Resources:

NCBI RefSeq record:
NM_001347994.1
NBCI Gene record:
NWD1 (284434)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001347994.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144026 CCTAGCCCTAAACCAATTATT pLKO.1 5083 3UTR 100% 15.000 21.000 N NWD1 n/a
2 TRCN0000143233 GTTCTCACATACGGTTGCAAA pLKO.1 2227 CDS 100% 4.950 6.930 N NWD1 n/a
3 TRCN0000139138 CCACAATGGAAGCTACGTCTA pLKO.1 3736 CDS 100% 4.050 5.670 N NWD1 n/a
4 TRCN0000140048 CTGTGGTTCTCACATACGGTT pLKO.1 2222 CDS 100% 2.640 3.696 N NWD1 n/a
5 TRCN0000142874 CCACAGAACCTCACAGTTTAT pLKO.1 5264 3UTR 100% 13.200 9.240 N NWD1 n/a
6 TRCN0000121929 CCCAGGGAAATGAAACCAAAT pLKO.1 4713 CDS 100% 10.800 7.560 N NWD1 n/a
7 TRCN0000139286 CATGTGGATGAGGCACACAAA pLKO.1 2966 CDS 100% 4.950 3.465 N NWD1 n/a
8 TRCN0000144072 CCCTCTTAAGAACTTCAAGAA pLKO.1 4609 CDS 100% 4.950 3.465 N NWD1 n/a
9 TRCN0000140871 GAGATCCAAGACCTCCACAAA pLKO.1 644 5UTR 100% 4.950 3.465 N NWD1 n/a
10 TRCN0000139878 GCCATGGATCTGGAACATGAA pLKO.1 3437 CDS 100% 4.950 3.465 N NWD1 n/a
11 TRCN0000122321 CCGGAAAGCAATCAACTGCAT pLKO.1 3967 CDS 100% 2.640 1.848 N NWD1 n/a
12 TRCN0000140928 CGAGAGAATTTCCAGTGCCTT pLKO.1 4565 CDS 100% 2.640 1.848 N NWD1 n/a
13 TRCN0000144785 GCAGGAGTTTCTGTATCTATT pLKO.1 5338 3UTR 100% 13.200 7.920 N NWD1 n/a
14 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 6777 3UTR 100% 4.950 2.475 Y ERAP2 n/a
15 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 6778 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347994.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.