Transcript: Human NM_001348023.2

Homo sapiens zinc finger protein 606 (ZNF606), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
ZNF606 (80095)
Length:
4019
CDS:
658..2766

Additional Resources:

NCBI RefSeq record:
NM_001348023.2
NBCI Gene record:
ZNF606 (80095)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001348023.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234341 CCCTTATGGTCTACCAGTAAT pLKO_005 3005 3UTR 100% 13.200 18.480 N ZNF606 n/a
2 TRCN0000234339 GACTACTCAGCCCTTAGTAAA pLKO_005 2038 CDS 100% 13.200 18.480 N ZNF606 n/a
3 TRCN0000016105 CCCTTATTGTACACCTAAGAA pLKO.1 2552 CDS 100% 5.625 7.875 N ZNF606 n/a
4 TRCN0000016104 GCAGATAAGGTTACCTGTGAA pLKO.1 1153 CDS 100% 4.950 6.930 N ZNF606 n/a
5 TRCN0000218898 ATCAGTCCATTCAACCTATTT pLKO_005 1199 CDS 100% 13.200 10.560 N ZNF606 n/a
6 TRCN0000234340 ATGAGAGTTCATCCCTTATTG pLKO_005 2540 CDS 100% 13.200 9.240 N ZNF606 n/a
7 TRCN0000234338 TTTAACCAGAGCCCATCATTT pLKO_005 1363 CDS 100% 13.200 9.240 N ZNF606 n/a
8 TRCN0000016106 GCAGAGTTTAGCCAGAACTTA pLKO.1 1036 CDS 100% 5.625 3.938 N ZNF606 n/a
9 TRCN0000016103 GCTCACCTTGTTAGACATCAA pLKO.1 2296 CDS 100% 4.950 3.465 N ZNF606 n/a
10 TRCN0000016107 CCAATTAGAAATGTACCACAT pLKO.1 930 CDS 100% 4.050 2.835 N ZNF606 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001348023.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08999 pDONR223 100% 88.5% 88.5% None 0_1ins270;1903G>A n/a
2 ccsbBroad304_08999 pLX_304 0% 88.5% 88.5% V5 0_1ins270;1903G>A n/a
Download CSV