Transcript: Mouse NM_001348101.1

Mus musculus N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1 (Ndst1), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-04-15
Taxon:
Mus musculus (mouse)
Gene:
Ndst1 (15531)
Length:
7857
CDS:
442..3090

Additional Resources:

NCBI RefSeq record:
NM_001348101.1
NBCI Gene record:
Ndst1 (15531)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001348101.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313476 AGCACTGTCGACTACCATAAA pLKO_005 2839 CDS 100% 13.200 18.480 N Ndst1 n/a
2 TRCN0000097923 CCGATACATCCTGGTGGATAT pLKO.1 1374 CDS 100% 10.800 15.120 N Ndst1 n/a
3 TRCN0000097924 CATTCGAACCTGGGCTTGAAA pLKO.1 1009 CDS 100% 5.625 7.875 N Ndst1 n/a
4 TRCN0000313475 GATACATCCTGGTGGATATTG pLKO_005 1376 CDS 100% 13.200 10.560 N Ndst1 n/a
5 TRCN0000097921 CCGCACACATATTCCAAACTT pLKO.1 1476 CDS 100% 5.625 4.500 N Ndst1 n/a
6 TRCN0000312388 CCGCACACATATTCCAAACTT pLKO_005 1476 CDS 100% 5.625 4.500 N Ndst1 n/a
7 TRCN0000313403 CCTGTTGTTGGAAGGTCATTT pLKO_005 3359 3UTR 100% 13.200 9.240 N Ndst1 n/a
8 TRCN0000349953 GCTGGTATGCCACTCATATTG pLKO_005 2705 CDS 100% 13.200 9.240 N Ndst1 n/a
9 TRCN0000008646 GCCAACTACTTTGATTCAGAA pLKO.1 2473 CDS 100% 4.950 3.465 N NDST1 n/a
10 TRCN0000097920 CCCAAATACTAAGAAGCTAAA pLKO.1 4039 3UTR 100% 10.800 6.480 N Ndst1 n/a
11 TRCN0000097922 GCCCTAAAGTACACCTTTCAT pLKO.1 2614 CDS 100% 5.625 3.375 N Ndst1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001348101.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13878 pDONR223 99.8% 56.1% 58.5% None (many diffs) n/a
2 ccsbBroad304_13878 pLX_304 0% 56.1% 58.5% V5 (many diffs) n/a
3 TRCN0000474419 GCCTTGGGTCGAAGTCGCCCGTTA pLX_317 30% 56.1% 58.5% V5 (many diffs) n/a
Download CSV