Transcript: Human NM_001348270.2

Homo sapiens serpin family B member 13 (SERPINB13), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
SERPINB13 (5275)
Length:
2910
CDS:
443..1081

Additional Resources:

NCBI RefSeq record:
NM_001348270.2
NBCI Gene record:
SERPINB13 (5275)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001348270.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416475 TACTCAGCTCATGTTACTATT pLKO_005 1485 3UTR 100% 13.200 10.560 N SERPINB13 n/a
2 TRCN0000418703 ACAACGACCTAAGCATGTTTG pLKO_005 621 CDS 100% 10.800 8.640 N SERPINB13 n/a
3 TRCN0000052364 CCATTCCTTTAGCTTCACTTT pLKO.1 556 CDS 100% 4.950 3.960 N SERPINB13 n/a
4 TRCN0000428337 ATTCTAGGGATTCCATATAAA pLKO_005 599 CDS 100% 15.000 10.500 N SERPINB13 n/a
5 TRCN0000052363 GCATAGGCTTTACTGTCACAT pLKO.1 954 CDS 100% 4.950 3.465 N SERPINB13 n/a
6 TRCN0000052366 GCACAATGAATCCAACAGCAT pLKO.1 1030 CDS 100% 2.640 1.848 N SERPINB13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001348270.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01196 pDONR223 100% 54.2% 54.2% None 0_1ins537 n/a
2 ccsbBroad304_01196 pLX_304 0% 54.2% 54.2% V5 0_1ins537 n/a
3 TRCN0000476987 ATATTTTTTCCTGCATAGAGCCCA pLX_317 26.8% 54.2% 54.2% V5 0_1ins537 n/a
Download CSV