Transcript: Human NM_001348281.1

Homo sapiens zinc finger protein 112 (ZNF112), transcript variant 3, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
ZNF112 (7771)
Length:
3791
CDS:
119..2911

Additional Resources:

NCBI RefSeq record:
NM_001348281.1
NBCI Gene record:
ZNF112 (7771)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001348281.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013092 CGAAGACTATGGTAAGGACTA pLKO.1 2842 CDS 100% 4.050 3.240 N ZNF112 n/a
2 TRCN0000230729 CACTAAGGAACAACCATATAA pLKO_005 1564 CDS 100% 15.000 10.500 N ZNF112 n/a
3 TRCN0000230727 TAGGGAATGGCTCCAATTATA pLKO_005 654 CDS 100% 15.000 10.500 N ZNF112 n/a
4 TRCN0000230730 AGTGATGAGCATGCCTAAATC pLKO_005 3157 3UTR 100% 13.200 9.240 N ZNF112 n/a
5 TRCN0000218258 CATTCAGCATAGGGTTCATAT pLKO_005 1462 CDS 100% 13.200 9.240 N ZNF112 n/a
6 TRCN0000013090 CCATGCAAATGTGGTGAATAT pLKO.1 1157 CDS 100% 13.200 9.240 N ZNF112 n/a
7 TRCN0000013088 CCCAACTTCAACATTCATAAT pLKO.1 3000 3UTR 100% 13.200 9.240 N ZNF112 n/a
8 TRCN0000013091 CCTATCCATGTACTGGGTATA pLKO.1 939 CDS 100% 10.800 7.560 N ZNF112 n/a
9 TRCN0000013089 GCGAGGAATGTGATAAGGGAT pLKO.1 1833 CDS 100% 2.640 1.848 N ZNF112 n/a
10 TRCN0000230728 AGTCATAGCTTAGACCTTAAT pLKO_005 1274 CDS 100% 13.200 7.920 N ZNF112 n/a
11 TRCN0000239543 ACAGGAGAGAAACCTTATAAA pLKO_005 1811 CDS 100% 15.000 7.500 Y Gm13212 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001348281.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07178 pDONR223 100% 97.2% 97% None (many diffs) n/a
2 ccsbBroad304_07178 pLX_304 0% 97.2% 97% V5 (many diffs) n/a
3 TRCN0000469888 CACTCAGCCATGGAGTGCTACGCC pLX_317 18.4% 97.2% 97% V5 (many diffs) n/a
Download CSV