Transcript: Human NM_001348325.2

Homo sapiens thyroid hormone receptor interactor 12 (TRIP12), transcript variant 15, mRNA.

Source:
NCBI, updated 2019-09-18
Taxon:
Homo sapiens (human)
Gene:
TRIP12 (9320)
Length:
10611
CDS:
691..6894

Additional Resources:

NCBI RefSeq record:
NM_001348325.2
NBCI Gene record:
TRIP12 (9320)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001348325.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000273136 TATCAGTCGATACTGGTATTA pLKO_005 5355 CDS 100% 13.200 18.480 N TRIP12 n/a
2 TRCN0000022377 CCGTATAACATGACTGTGTAT pLKO.1 4975 CDS 100% 4.950 6.930 N TRIP12 n/a
3 TRCN0000273207 GTATCTAAGACTGGTTATATT pLKO_005 6375 CDS 100% 15.000 10.500 N TRIP12 n/a
4 TRCN0000273210 CCACTACTCAGTCACCTAAAT pLKO_005 4010 CDS 100% 13.200 9.240 N TRIP12 n/a
5 TRCN0000273206 GTAGGCCTGATCATGGTTATA pLKO_005 6563 CDS 100% 13.200 9.240 N TRIP12 n/a
6 TRCN0000022376 CCCTAAAGTTAGCCTTCCTAA pLKO.1 1617 CDS 100% 4.950 3.465 N TRIP12 n/a
7 TRCN0000022375 CCGGAGTTTGAATCCACCTTT pLKO.1 6702 CDS 100% 4.950 3.465 N TRIP12 n/a
8 TRCN0000022374 CCTGAGTCAAGGAAACATGTT pLKO.1 6968 3UTR 100% 4.950 2.970 N TRIP12 n/a
9 TRCN0000273135 CCTGAGTCAAGGAAACATGTT pLKO_005 6968 3UTR 100% 4.950 2.970 N TRIP12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001348325.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.