Transcript: Human NM_001348441.1

Homo sapiens adaptor related protein complex 3 subunit beta 2 (AP3B2), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
AP3B2 (8120)
Length:
1216
CDS:
459..896

Additional Resources:

NCBI RefSeq record:
NM_001348441.1
NBCI Gene record:
AP3B2 (8120)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001348441.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146345 CTGCTGTAATGGGCATTAATT pLKO.1 451 5UTR 100% 15.000 10.500 N AP3B2 n/a
2 TRCN0000242593 CCTGTTTGGCTCCCATCTATA pLKO_005 913 3UTR 100% 13.200 9.240 N AP3B2 n/a
3 TRCN0000181023 CCACTGCTGTAATGGGCATTA pLKO.1 448 5UTR 100% 10.800 7.560 N AP3B2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001348441.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13990 pDONR223 100% 13.3% 3.2% None 0_1ins2812 n/a
2 ccsbBroad304_13990 pLX_304 0% 13.3% 3.2% V5 (not translated due to prior stop codon) 0_1ins2812 n/a
3 TRCN0000476411 GTACTTGAACTTTGCCACTTTCAG pLX_317 11.5% 13.3% 3.2% V5 (not translated due to prior stop codon) 0_1ins2812 n/a
Download CSV