Transcript: Human NM_001348547.2

Homo sapiens transmembrane protein 229B (TMEM229B), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
TMEM229B (161145)
Length:
3920
CDS:
266..769

Additional Resources:

NCBI RefSeq record:
NM_001348547.2
NBCI Gene record:
TMEM229B (161145)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001348547.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425943 TGAGCAGCGATGGACTATGTA pLKO_005 1043 3UTR 100% 5.625 7.875 N TMEM229B n/a
2 TRCN0000139249 CGTGGTGAACTTGAACTGGAA pLKO.1 364 CDS 100% 2.640 3.696 N TMEM229B n/a
3 TRCN0000413431 GACTACTCCCAGTTCGACTTT pLKO_005 575 CDS 100% 4.950 3.960 N TMEM229B n/a
4 TRCN0000425787 GGTGCTTGCTTGCAACCAATA pLKO_005 1202 3UTR 100% 10.800 7.560 N TMEM229B n/a
5 TRCN0000139482 CCCTCCGATCTGGATTTAGTT pLKO.1 1149 3UTR 100% 5.625 3.938 N TMEM229B n/a
6 TRCN0000139313 CCTCATCATGGAGCAGTTCAT pLKO.1 649 CDS 100% 4.950 3.465 N TMEM229B n/a
7 TRCN0000139723 CTACTTCTGCGAGGTGATGTT pLKO.1 325 CDS 100% 4.950 3.465 N TMEM229B n/a
8 TRCN0000139104 CTCCCAGTTCGACTTTGACTT pLKO.1 580 CDS 100% 4.950 3.465 N TMEM229B n/a
9 TRCN0000139859 CTTTGACTTCATGGGCCTCAT pLKO.1 592 CDS 100% 4.050 2.430 N TMEM229B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001348547.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09735 pDONR223 100% 99.8% 100% None 24G>A n/a
2 ccsbBroad304_09735 pLX_304 0% 99.8% 100% V5 24G>A n/a
3 TRCN0000479943 AACCATTGGACCTGATCTCATGTT pLX_317 60.8% 99.8% 100% V5 24G>A n/a
Download CSV