Transcript: Human NM_001348732.2

Homo sapiens kinase D interacting substrate 220 (KIDINS220), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
KIDINS220 (57498)
Length:
7291
CDS:
171..5429

Additional Resources:

NCBI RefSeq record:
NM_001348732.2
NBCI Gene record:
KIDINS220 (57498)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001348732.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052632 GCCGATCAGAACCTTCATTAA pLKO.1 4796 CDS 100% 13.200 10.560 N KIDINS220 n/a
2 TRCN0000052629 CCGAGTATAGAGATGCCTATA pLKO.1 4255 CDS 100% 1.080 0.864 N KIDINS220 n/a
3 TRCN0000310512 CCGAGTATAGAGATGCCTATA pLKO_005 4255 CDS 100% 1.080 0.864 N KIDINS220 n/a
4 TRCN0000303763 GAGGTGAGATCTGAGTATAAA pLKO_005 5708 3UTR 100% 15.000 10.500 N KIDINS220 n/a
5 TRCN0000331266 GGCCTGCAAGATCCAATTATA pLKO_005 5013 CDS 100% 15.000 10.500 N KIDINS220 n/a
6 TRCN0000052628 CCGGACTTCATGGCTCATATT pLKO.1 3101 CDS 100% 13.200 9.240 N KIDINS220 n/a
7 TRCN0000299847 CCGGACTTCATGGCTCATATT pLKO_005 3101 CDS 100% 13.200 9.240 N KIDINS220 n/a
8 TRCN0000052631 CGAGTATTCAAGACTGAAGAT pLKO.1 2082 CDS 100% 4.950 3.465 N KIDINS220 n/a
9 TRCN0000052630 CGGGAAATTATTGCAGATGTT pLKO.1 3345 CDS 100% 4.950 3.465 N KIDINS220 n/a
10 TRCN0000174250 CGGGAAATTATTGCAGATGTT pLKO.1 3345 CDS 100% 4.950 3.465 N KIDINS220 n/a
11 TRCN0000310514 CGGGAAATTATTGCAGATGTT pLKO_005 3345 CDS 100% 4.950 3.465 N KIDINS220 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001348732.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.