Transcript: Human NM_001348749.2

Homo sapiens DENN domain containing 5A (DENND5A), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
DENND5A (23258)
Length:
4919
CDS:
282..4073

Additional Resources:

NCBI RefSeq record:
NM_001348749.2
NBCI Gene record:
DENND5A (23258)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001348749.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000180369 GCGCTTCAACTCCTATGACAT pLKO.1 776 CDS 100% 4.950 6.930 N DENND5A n/a
2 TRCN0000281013 GCGCTTCAACTCCTATGACAT pLKO_005 776 CDS 100% 4.950 6.930 N DENND5A n/a
3 TRCN0000150228 GCACAGTTTCACAGAAGTAAA pLKO.1 4681 3UTR 100% 13.200 10.560 N DENND5A n/a
4 TRCN0000297928 GCACAGTTTCACAGAAGTAAA pLKO_005 4681 3UTR 100% 13.200 10.560 N DENND5A n/a
5 TRCN0000181126 CCGTACCACATTCTGATCGTA pLKO.1 3072 CDS 100% 3.000 2.400 N DENND5A n/a
6 TRCN0000281014 CCGTACCACATTCTGATCGTA pLKO_005 3072 CDS 100% 3.000 2.400 N DENND5A n/a
7 TRCN0000180294 CCTGCTCTACTCACAGCATTA pLKO.1 1142 CDS 100% 10.800 7.560 N DENND5A n/a
8 TRCN0000281077 CCTGCTCTACTCACAGCATTA pLKO_005 1142 CDS 100% 10.800 7.560 N DENND5A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001348749.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11706 pDONR223 100% 69% 69% None 1_1173del n/a
2 ccsbBroad304_11706 pLX_304 0% 69% 69% V5 1_1173del n/a
3 TRCN0000467580 AGCCGGAGACTTCGGGGAAAGCCT pLX_317 15.3% 69% 69% V5 1_1173del n/a
Download CSV