Transcript: Human NM_001348773.2

Homo sapiens colipase like 1 (CLPSL1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
CLPSL1 (340204)
Length:
813
CDS:
93..362

Additional Resources:

NCBI RefSeq record:
NM_001348773.2
NBCI Gene record:
CLPSL1 (340204)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001348773.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152648 GCTGTTCCTTCTCTTCTTCTT pLKO.1 119 CDS 100% 4.950 3.465 N CLPSL1 n/a
2 TRCN0000154119 CTTCTTCTTTCTCTTCCTCCT pLKO.1 131 CDS 100% 2.160 1.296 N CLPSL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001348773.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05469 pDONR223 100% 69.8% 63.6% None (many diffs) n/a
2 ccsbBroad304_05469 pLX_304 0% 69.8% 63.6% V5 (many diffs) n/a
3 TRCN0000475797 TTACTGGTTTAACGATTTGGTCTT pLX_317 55.9% 69.8% 63.6% V5 (many diffs) n/a
Download CSV