Transcript: Human NM_001348951.2

Homo sapiens WD repeat domain 49 (WDR49), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
WDR49 (151790)
Length:
3609
CDS:
299..3415

Additional Resources:

NCBI RefSeq record:
NM_001348951.2
NBCI Gene record:
WDR49 (151790)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001348951.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414948 TATCACTCTCGGCTCAATTTA pLKO_005 1400 CDS 100% 15.000 21.000 N WDR49 n/a
2 TRCN0000155963 CCGTCCAATTCTTTGTGGAAA pLKO.1 1521 CDS 100% 4.950 6.930 N WDR49 n/a
3 TRCN0000413478 TCAGACCATCAGAAGATATAA pLKO_005 3042 CDS 100% 15.000 12.000 N WDR49 n/a
4 TRCN0000156883 GCCATGAGAAAGCAGTCACTT pLKO.1 1758 CDS 100% 4.950 3.960 N WDR49 n/a
5 TRCN0000154787 GCTAGCATTGTTGGCAATGAA pLKO.1 1711 CDS 100% 0.563 0.450 N WDR49 n/a
6 TRCN0000158329 CAGCACAGATGGGACTGTAAA pLKO.1 1951 CDS 100% 13.200 9.240 N WDR49 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001348951.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05057 pDONR223 100% 67.1% 67.1% None 1_1023del n/a
2 ccsbBroad304_05057 pLX_304 0% 67.1% 67.1% V5 1_1023del n/a
3 TRCN0000476940 CTAAAATAGCACTTGACAGATAGC pLX_317 16.9% 67.1% 67.1% V5 1_1023del n/a
Download CSV