Transcript: Human NM_001349107.2

Homo sapiens ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 3 (ST6GALNAC3), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
ST6GALNAC3 (256435)
Length:
6728
CDS:
122..931

Additional Resources:

NCBI RefSeq record:
NM_001349107.2
NBCI Gene record:
ST6GALNAC3 (256435)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001349107.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035367 GTTTGCTAAATGGGCCAAGAA pLKO.1 868 CDS 100% 4.950 6.930 N ST6GALNAC3 n/a
2 TRCN0000035368 GAACTCACTATGGATACATAA pLKO.1 297 CDS 100% 13.200 9.240 N ST6GALNAC3 n/a
3 TRCN0000453943 GAACTCACTATGGATACATAA pLKO_005 297 CDS 100% 13.200 9.240 N St6galnac3 n/a
4 TRCN0000415633 GATGGTGACTCTGCTAGTAAT pLKO_005 1071 3UTR 100% 13.200 9.240 N ST6GALNAC3 n/a
5 TRCN0000431259 TGATCTTGCCGCATCACTTAA pLKO_005 944 3UTR 100% 13.200 9.240 N ST6GALNAC3 n/a
6 TRCN0000035364 GCGTCTTGTAAATGAAGTGAA pLKO.1 196 CDS 100% 4.950 3.465 N ST6GALNAC3 n/a
7 TRCN0000035366 GCTTCATAGCAGCGTTCCTTT pLKO.1 162 CDS 100% 4.950 3.465 N ST6GALNAC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001349107.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09915 pDONR223 100% 88.1% 88.1% None 623_624ins108 n/a
2 ccsbBroad304_09915 pLX_304 0% 88.1% 88.1% V5 623_624ins108 n/a
3 TRCN0000471367 GGGACCGATTACGATATGACAAGC pLX_317 44.5% 88.1% 88.1% V5 623_624ins108 n/a
Download CSV