Transcript: Human NM_001349108.2

Homo sapiens ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 3 (ST6GALNAC3), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
ST6GALNAC3 (256435)
Length:
6641
CDS:
122..844

Additional Resources:

NCBI RefSeq record:
NM_001349108.2
NBCI Gene record:
ST6GALNAC3 (256435)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001349108.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035365 GCAAGACAGAAGGGTATAGAA pLKO.1 654 CDS 100% 5.625 7.875 N ST6GALNAC3 n/a
2 TRCN0000035367 GTTTGCTAAATGGGCCAAGAA pLKO.1 781 CDS 100% 4.950 6.930 N ST6GALNAC3 n/a
3 TRCN0000415633 GATGGTGACTCTGCTAGTAAT pLKO_005 984 3UTR 100% 13.200 9.240 N ST6GALNAC3 n/a
4 TRCN0000431259 TGATCTTGCCGCATCACTTAA pLKO_005 857 3UTR 100% 13.200 9.240 N ST6GALNAC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001349108.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09915 pDONR223 100% 77.5% 76.3% None (many diffs) n/a
2 ccsbBroad304_09915 pLX_304 0% 77.5% 76.3% V5 (many diffs) n/a
3 TRCN0000471367 GGGACCGATTACGATATGACAAGC pLX_317 44.5% 77.5% 76.3% V5 (many diffs) n/a
Download CSV