Transcript: Human NM_001349268.2

Homo sapiens transmembrane and coiled-coil domain family 1 (TMCC1), transcript variant 9, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
TMCC1 (23023)
Length:
6052
CDS:
402..2363

Additional Resources:

NCBI RefSeq record:
NM_001349268.2
NBCI Gene record:
TMCC1 (23023)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001349268.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000130830 GATAGTGTCAAAGGTGGGTTT pLKO.1 1434 CDS 100% 4.050 5.670 N TMCC1 n/a
2 TRCN0000129428 GATTGCCTCACTCATTCGGAA pLKO.1 1514 CDS 100% 2.640 3.696 N TMCC1 n/a
3 TRCN0000130698 CAAACTTTCAGTCTAGCCCAA pLKO.1 1627 CDS 100% 2.160 3.024 N TMCC1 n/a
4 TRCN0000127504 CAGGACGTTCAGCACTTTATT pLKO.1 2258 CDS 100% 15.000 12.000 N TMCC1 n/a
5 TRCN0000130174 CGATTGGAAGAACAGCTAAAT pLKO.1 1920 CDS 100% 13.200 9.240 N TMCC1 n/a
6 TRCN0000128872 GAACATTATCAGAGGGACTAT pLKO.1 1854 CDS 100% 4.950 3.465 N TMCC1 n/a
7 TRCN0000130525 GCACTTTATTCCTTGTGGTTT pLKO.1 2269 CDS 100% 4.950 3.465 N TMCC1 n/a
8 TRCN0000128950 GAAGAACAGCTAAATGACCTA pLKO.1 1926 CDS 100% 2.640 1.848 N TMCC1 n/a
9 TRCN0000131093 GACTCTTTAGAGGAAGGGCAA pLKO.1 1572 CDS 100% 2.160 1.512 N TMCC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001349268.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07830 pDONR223 100% 99.9% 99.8% None 493A>G n/a
2 ccsbBroad304_07830 pLX_304 0% 99.9% 99.8% V5 493A>G n/a
3 TRCN0000470452 CGTGGCACTCAGACCCTCCTAATC pLX_317 21.1% 99.9% 99.8% V5 493A>G n/a
Download CSV