Transcript: Human NM_001349933.1

Homo sapiens torsin 1A interacting protein 2 (TOR1AIP2), transcript variant 5, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
TOR1AIP2 (163590)
Length:
8066
CDS:
712..1107

Additional Resources:

NCBI RefSeq record:
NM_001349933.1
NBCI Gene record:
TOR1AIP2 (163590)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001349933.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144773 CCGTATTAACAGAGCTGATTA pLKO.1 834 CDS 100% 13.200 18.480 N TOR1AIP2 n/a
2 TRCN0000145490 GTTGTACCAAACTGAACTTGT pLKO.1 783 CDS 100% 4.950 6.930 N TOR1AIP2 n/a
3 TRCN0000143471 GCTGATTATTGTCCTGAGTGT pLKO.1 847 CDS 100% 2.640 3.696 N TOR1AIP2 n/a
4 TRCN0000140968 CACCAGATGGACCTTTGAGAA pLKO.1 942 CDS 100% 4.950 3.960 N TOR1AIP2 n/a
5 TRCN0000198007 CACTGGTTGTACCAAACTGAA pLKO.1 778 CDS 100% 4.950 3.465 N Tor1aip2 n/a
6 TRCN0000142737 CCTGCTAATAGAAGCCTTGTT pLKO.1 880 CDS 100% 4.950 3.465 N TOR1AIP2 n/a
7 TRCN0000142738 CCTTGTTCTTCCTTGGTCTTT pLKO.1 894 CDS 100% 4.950 3.465 N TOR1AIP2 n/a
8 TRCN0000143680 GTCCTGAGTGTTATCCTGATA pLKO.1 857 CDS 100% 4.950 3.465 N TOR1AIP2 n/a
9 TRCN0000141875 GCCTTGTTCTTCCTTGGTCTT pLKO.1 893 CDS 100% 4.050 2.835 N TOR1AIP2 n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2901 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2901 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001349933.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05127 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05127 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468459 TCGTCAGTTTTATTACCGTTAAGC pLX_317 95.6% 100% 100% V5 n/a
Download CSV