Transcript: Human NM_001349936.2

Homo sapiens torsin 1A interacting protein 2 (TOR1AIP2), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
TOR1AIP2 (163590)
Length:
8184
CDS:
677..2089

Additional Resources:

NCBI RefSeq record:
NM_001349936.2
NBCI Gene record:
TOR1AIP2 (163590)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001349936.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000130544 GCCACCATCATATTTACAGCA pLKO.1 1556 CDS 100% 2.640 3.696 N TOR1AIP2 n/a
2 TRCN0000148760 CCACATGGACTCAGACAAATT pLKO.1 1984 CDS 100% 13.200 9.240 N TOR1AIP2 n/a
3 TRCN0000149359 GCTTGAGGAAATAGCCTGAAA pLKO.1 2182 3UTR 100% 4.950 3.465 N TOR1AIP2 n/a
4 TRCN0000150217 GCTCCACTTTGATCTTCTATA pLKO.1 1794 CDS 100% 13.200 7.920 N TOR1AIP2 n/a
5 TRCN0000149390 GCAACATTGCACAGGAAGATA pLKO.1 2375 3UTR 100% 5.625 3.375 N TOR1AIP2 n/a
6 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5355 3UTR 100% 5.625 2.813 Y KLHL30 n/a
7 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 5218 3UTR 100% 2.640 1.320 Y LINC01098 n/a
8 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5355 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001349936.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05128 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05128 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472022 ATTTCGAGACTACGAACTGGAAGT pLX_317 32.5% 100% 100% V5 n/a
Download CSV