Transcript: Human NM_001349945.2

Homo sapiens serine palmitoyltransferase long chain base subunit 3 (SPTLC3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
SPTLC3 (55304)
Length:
6063
CDS:
169..1827

Additional Resources:

NCBI RefSeq record:
NM_001349945.2
NBCI Gene record:
SPTLC3 (55304)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001349945.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431170 GCAAATCATCAGATCACTAAA pLKO_005 1395 CDS 100% 13.200 18.480 N SPTLC3 n/a
2 TRCN0000434772 GAGCTTTGAACTCGAAGATTA pLKO_005 1806 CDS 100% 13.200 10.560 N SPTLC3 n/a
3 TRCN0000434839 GAAGGACCTCGTGGATTATTT pLKO_005 1317 CDS 100% 15.000 10.500 N SPTLC3 n/a
4 TRCN0000133841 CACTTACATGGGATATGGAAT pLKO.1 363 CDS 100% 4.950 3.465 N SPTLC3 n/a
5 TRCN0000138762 GCAATGGCTCACAAAGCAGAA pLKO.1 230 CDS 100% 4.050 2.835 N SPTLC3 n/a
6 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5400 3UTR 100% 5.625 2.813 Y KLHL30 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2061 3UTR 100% 4.950 2.475 Y KAAG1 n/a
8 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5400 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001349945.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12203 pDONR223 100% 27.8% 18.5% None (many diffs) n/a
2 ccsbBroad304_12203 pLX_304 0% 27.8% 18.5% V5 (many diffs) n/a
3 TRCN0000474829 ACTAAAGTGCGAAGCAAGCCTCCT pLX_317 74.6% 27.8% 18.5% V5 (many diffs) n/a
Download CSV