Transcript: Human NM_001350062.1

Homo sapiens tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 (TANC1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
TANC1 (85461)
Length:
6904
CDS:
275..5257

Additional Resources:

NCBI RefSeq record:
NM_001350062.1
NBCI Gene record:
TANC1 (85461)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001350062.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419129 GTTGACTCCTGGTGGTAAATT pLKO_005 5297 3UTR 100% 15.000 21.000 N TANC1 n/a
2 TRCN0000149444 GCAGATTGTTAGACTGCTGTT pLKO.1 3046 CDS 100% 4.050 5.670 N TANC1 n/a
3 TRCN0000148462 CCTGATTATGGAGATACGCTT pLKO.1 1475 CDS 100% 2.640 3.696 N TANC1 n/a
4 TRCN0000434409 TACAGGACAGAAGTGTTAAAT pLKO_005 2453 CDS 100% 15.000 12.000 N TANC1 n/a
5 TRCN0000128365 GCAGTTCCTATAAAGGGATTA pLKO.1 5833 3UTR 100% 10.800 8.640 N TANC1 n/a
6 TRCN0000416580 GATCTGATGCCATTGATATAT pLKO_005 5374 3UTR 100% 15.000 10.500 N TANC1 n/a
7 TRCN0000149388 GCATTCTTAGTGGCGCTTATA pLKO.1 6013 3UTR 100% 13.200 9.240 N TANC1 n/a
8 TRCN0000128884 GCCAAACCAAAGCGATCATTT pLKO.1 5219 CDS 100% 13.200 9.240 N TANC1 n/a
9 TRCN0000150272 GCAGAATATGAGAACACCTAA pLKO.1 5798 3UTR 100% 4.950 3.465 N TANC1 n/a
10 TRCN0000130337 GCTTCAGTGCAACATGAAGTT pLKO.1 1885 CDS 100% 0.495 0.347 N TANC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001350062.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.