Transcript: Human NM_001350084.2

Homo sapiens sterile alpha motif domain containing 9 like (SAMD9L), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
SAMD9L (219285)
Length:
6569
CDS:
654..5408

Additional Resources:

NCBI RefSeq record:
NM_001350084.2
NBCI Gene record:
SAMD9L (219285)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001350084.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432393 ATCCGGGACAATTAGATAATT pLKO_005 910 CDS 100% 15.000 21.000 N SAMD9L n/a
2 TRCN0000432676 TCAATATCCAGGTCCTTATTT pLKO_005 4916 CDS 100% 15.000 21.000 N SAMD9L n/a
3 TRCN0000426166 ATGAGCAATACGGGCAAATTC pLKO_005 742 CDS 100% 13.200 18.480 N SAMD9L n/a
4 TRCN0000167801 GAACTAACAAACCACAGTATT pLKO.1 2460 CDS 100% 13.200 18.480 N SAMD9L n/a
5 TRCN0000167382 GCAGACAGTATTGCACTAAAT pLKO.1 3207 CDS 100% 13.200 18.480 N SAMD9L n/a
6 TRCN0000426629 TGATCAATCTGGTCACCTATA pLKO_005 2995 CDS 100% 10.800 15.120 N SAMD9L n/a
7 TRCN0000167458 GCTCTTATGTTACTGACTCTA pLKO.1 3439 CDS 100% 4.950 6.930 N SAMD9L n/a
8 TRCN0000167031 CCTGTAGTTCAAATACGTTTA pLKO.1 5421 3UTR 100% 10.800 8.640 N SAMD9L n/a
9 TRCN0000412819 ACCTCATCTTGGTATCAATAA pLKO_005 5843 3UTR 100% 13.200 9.240 N SAMD9L n/a
10 TRCN0000166892 CATCGCTACATAGAACATTAT pLKO.1 1176 CDS 100% 13.200 9.240 N SAMD9L n/a
11 TRCN0000432667 CTGTAGTTCAAATACGTTTAT pLKO_005 5422 3UTR 100% 13.200 9.240 N SAMD9L n/a
12 TRCN0000435729 GTCATTGAAGTTGATACTATT pLKO_005 1563 CDS 100% 13.200 9.240 N SAMD9L n/a
13 TRCN0000429581 TAACTGTCTATAGGGCAATAA pLKO_005 5684 3UTR 100% 13.200 9.240 N SAMD9L n/a
14 TRCN0000413689 GTGTTAGATGAAGTAGCAAAT pLKO_005 1074 CDS 100% 10.800 7.560 N SAMD9L n/a
15 TRCN0000167614 GAACATAGAAAGAGTGTCTTT pLKO.1 5333 CDS 100% 4.950 3.465 N SAMD9L n/a
16 TRCN0000172518 CCAAGGTTTGTGGAAGTCCTT pLKO.1 1512 CDS 100% 2.640 1.848 N SAMD9L n/a
17 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5922 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001350084.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14435 pDONR223 100% 79.9% 79.2% None (many diffs) n/a
2 ccsbBroad304_14435 pLX_304 0% 79.9% 79.2% V5 (many diffs) n/a
3 TRCN0000479267 GAAGCAGTCACTGTACTAATAATC pLX_317 8.3% 79.9% 79.2% V5 (many diffs) n/a
Download CSV