Transcript: Human NM_001350140.2

Homo sapiens zinc finger MYM-type containing 4 (ZMYM4), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
ZMYM4 (9202)
Length:
6673
CDS:
618..4292

Additional Resources:

NCBI RefSeq record:
NM_001350140.2
NBCI Gene record:
ZMYM4 (9202)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001350140.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219845 ATGATCCAGACAGTATCTTAT pLKO.1 3550 CDS 100% 13.200 18.480 N ZMYM4 n/a
2 TRCN0000183255 GCCAATAAACTATCCAGAAAT pLKO.1 6044 3UTR 100% 13.200 10.560 N ZMYM4 n/a
3 TRCN0000147075 CGAAGTGTTGTGAAACTCAAA pLKO.1 1683 CDS 100% 4.950 3.960 N ZMYM4 n/a
4 TRCN0000353015 CGAAGTGTTGTGAAACTCAAA pLKO_005 1683 CDS 100% 4.950 3.960 N ZMYM4 n/a
5 TRCN0000219843 TACCAGAATGTGGTCCATAAA pLKO.1 1020 CDS 100% 0.000 0.000 N ZMYM4 n/a
6 TRCN0000344623 CAGATTTGAAGACCCAATAAA pLKO_005 4759 3UTR 100% 15.000 10.500 N ZMYM4 n/a
7 TRCN0000183654 CCCAAATTGGTACAGAATAAT pLKO.1 1992 CDS 100% 15.000 10.500 N ZMYM4 n/a
8 TRCN0000219844 ACCAGAACTTCTTGACTATAA pLKO.1 1736 CDS 100% 13.200 9.240 N ZMYM4 n/a
9 TRCN0000333030 ACCAGAACTTCTTGACTATAA pLKO_005 1736 CDS 100% 13.200 9.240 N ZMYM4 n/a
10 TRCN0000146754 CCAGATTTGAAGACCCAATAA pLKO.1 4758 3UTR 100% 13.200 9.240 N ZMYM4 n/a
11 TRCN0000147340 GCTGAATCACTATGCCTTAAA pLKO.1 2969 CDS 100% 13.200 9.240 N ZMYM4 n/a
12 TRCN0000344622 GCTGAATCACTATGCCTTAAA pLKO_005 2969 CDS 100% 13.200 9.240 N ZMYM4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001350140.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11346 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_11346 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478193 AGCGGCCCGTTCTTTAACCCATTT pLX_317 7.1% 100% 100% V5 n/a
Download CSV