Transcript: Human NM_001350194.2

Homo sapiens family with sequence similarity 53 member C (FAM53C), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
FAM53C (51307)
Length:
3510
CDS:
195..740

Additional Resources:

NCBI RefSeq record:
NM_001350194.2
NBCI Gene record:
FAM53C (51307)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001350194.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139648 CCTTCGTTGGACTTTGACAAG pLKO.1 453 CDS 100% 4.050 5.670 N FAM53C n/a
2 TRCN0000280973 CCTTCGTTGGACTTTGACAAG pLKO_005 453 CDS 100% 4.050 5.670 N FAM53C n/a
3 TRCN0000143496 GCAGCCTATGATTGCTTCTTT pLKO.1 3046 3UTR 100% 5.625 3.938 N FAM53C n/a
4 TRCN0000281045 GCAGCCTATGATTGCTTCTTT pLKO_005 3046 3UTR 100% 5.625 3.938 N FAM53C n/a
5 TRCN0000121786 CAAGATGAATCAGAAACCATA pLKO.1 470 CDS 100% 4.950 3.465 N FAM53C n/a
6 TRCN0000280975 CAAGATGAATCAGAAACCATA pLKO_005 470 CDS 100% 4.950 3.465 N FAM53C n/a
7 TRCN0000139229 CAGACTCTGGATGAGCTGAAA pLKO.1 228 CDS 100% 4.950 3.465 N FAM53C n/a
8 TRCN0000140503 GCCTTCGTTGGACTTTGACAA pLKO.1 452 CDS 100% 4.950 3.465 N FAM53C n/a
9 TRCN0000139906 GAAACCATACTCAGGAGGTCT pLKO.1 482 CDS 100% 2.640 1.848 N FAM53C n/a
10 TRCN0000122782 GAAATGCACACGCTTCAGCAT pLKO.1 245 CDS 100% 2.640 1.848 N FAM53C n/a
11 TRCN0000281044 GAAATGCACACGCTTCAGCAT pLKO_005 245 CDS 100% 2.640 1.848 N FAM53C n/a
12 TRCN0000121855 GACTTGAATTTGATTGAGGAA pLKO.1 714 CDS 100% 2.640 1.848 N FAM53C n/a
13 TRCN0000193088 CTTTGACAAGATGAATCAGAA pLKO.1 464 CDS 100% 4.950 2.970 N Fam53c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001350194.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03278 pDONR223 100% 46.1% 46.1% None 135_136ins633 n/a
2 ccsbBroad304_03278 pLX_304 0% 46.1% 46.1% V5 135_136ins633 n/a
3 TRCN0000473319 GGGCTCAACACTTCGCTGTGCTGT pLX_317 37.5% 46.1% 46.1% V5 135_136ins633 n/a
Download CSV