Transcript: Human NM_001350262.1

Homo sapiens zinc finger CCCH-type containing 11A (ZC3H11A), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-02-26
Taxon:
Homo sapiens (human)
Gene:
ZC3H11A (9877)
Length:
4847
CDS:
669..3101

Additional Resources:

NCBI RefSeq record:
NM_001350262.1
NBCI Gene record:
ZC3H11A (9877)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001350262.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000133870 CGTGGAGAATTGCAAACTAAA pLKO.1 1785 CDS 100% 13.200 18.480 N ZC3H11A n/a
2 TRCN0000134371 GCAGTATTAGAACAGAAGCTA pLKO.1 2266 CDS 100% 3.000 2.100 N ZC3H11A n/a
3 TRCN0000322870 ACGCATCCACCAGTTGTAATT pLKO_005 1119 CDS 100% 13.200 7.920 N ZC3H11A n/a
4 TRCN0000322869 CCGGAAACCTGCAGTCAATAT pLKO_005 1259 CDS 100% 13.200 6.600 Y ZC3H11A n/a
5 TRCN0000166954 GCAGTGAAATTCCTTGTTATT pLKO.1 850 CDS 100% 13.200 6.600 Y ZC3H11A n/a
6 TRCN0000322943 TCGGCACATGGAGATTGATAA pLKO_005 824 CDS 100% 13.200 6.600 Y ZC3H11A n/a
7 TRCN0000322868 CATCACAATAGAGGACGATAT pLKO_005 915 CDS 100% 10.800 5.400 Y ZC3H11A n/a
8 TRCN0000322871 TTTACCTGAGATGATCATTTC pLKO_005 3171 3UTR 100% 10.800 5.400 Y ZC3H11A n/a
9 TRCN0000167703 GCGTTATGAAAGTAGAAAGTT pLKO.1 1078 CDS 100% 5.625 2.813 Y ZC3H11A n/a
10 TRCN0000136440 CCATCACAATAGAGGACGATA pLKO.1 914 CDS 100% 4.950 2.475 Y ZC3H11A n/a
11 TRCN0000134246 CTGTGGTTAAAGTTGTGTCAT pLKO.1 2635 CDS 100% 4.950 2.475 Y ZC3H11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001350262.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02263 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02263 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465595 GACCCAACGGCATACCCTTGCCGA pLX_317 11.3% 100% 100% V5 n/a
Download CSV