Transcript: Human NM_001350320.1

Homo sapiens erythrocyte membrane protein band 4.1 like 2 (EPB41L2), transcript variant 23, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
EPB41L2 (2037)
Length:
3541
CDS:
683..2284

Additional Resources:

NCBI RefSeq record:
NM_001350320.1
NBCI Gene record:
EPB41L2 (2037)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001350320.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117095 GCCAGTGTAATCACAGTAGAA pLKO.1 1679 CDS 100% 4.950 6.930 N EPB41L2 n/a
2 TRCN0000288853 GCCAGTGTAATCACAGTAGAA pLKO_005 1679 CDS 100% 4.950 6.930 N EPB41L2 n/a
3 TRCN0000117094 CCAAAGTCTTATGAAGGATTT pLKO.1 1156 CDS 100% 10.800 7.560 N EPB41L2 n/a
4 TRCN0000288856 CCAAAGTCTTATGAAGGATTT pLKO_005 1156 CDS 100% 10.800 7.560 N EPB41L2 n/a
5 TRCN0000117092 CCTATCTCTTTCAGATAGTTT pLKO.1 3255 3UTR 100% 0.563 0.394 N EPB41L2 n/a
6 TRCN0000288854 CCTATCTCTTTCAGATAGTTT pLKO_005 3255 3UTR 100% 0.563 0.394 N EPB41L2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001350320.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10802 pDONR223 100% 24.7% 23.8% None 0_1ins1206;664delA;695_1599del n/a
2 ccsbBroad304_10802 pLX_304 0% 24.7% 23.8% V5 0_1ins1206;664delA;695_1599del n/a
3 TRCN0000471036 TAGAGCCGATTGATCGTACCCGCC pLX_317 25.8% 24.7% 23.8% V5 0_1ins1206;664delA;695_1599del n/a
Download CSV