Transcript: Human NM_001350483.1

Homo sapiens cyclase associated actin cytoskeleton regulatory protein 1 (CAP1), transcript variant 12, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
CAP1 (10487)
Length:
2780
CDS:
215..1639

Additional Resources:

NCBI RefSeq record:
NM_001350483.1
NBCI Gene record:
CAP1 (10487)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001350483.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029353 CCCATCTCAGAGCAGATCAAA pLKO.1 530 CDS 100% 5.625 3.938 N CAP1 n/a
2 TRCN0000278324 CCCATCTCAGAGCAGATCAAA pLKO_005 530 CDS 100% 5.625 3.938 N CAP1 n/a
3 TRCN0000029351 CCTGGCCCTTATGTGAAAGAA pLKO.1 659 CDS 100% 5.625 3.938 N CAP1 n/a
4 TRCN0000278326 CCTGGCCCTTATGTGAAAGAA pLKO_005 659 CDS 100% 5.625 3.938 N CAP1 n/a
5 TRCN0000029349 GCAGGCTTACATTAAGGAGTT pLKO.1 790 CDS 100% 4.050 2.835 N CAP1 n/a
6 TRCN0000278322 GCAGGCTTACATTAAGGAGTT pLKO_005 790 CDS 100% 4.050 2.835 N CAP1 n/a
7 TRCN0000029352 GCAGTTCAAGACCCTATGGAA pLKO.1 1576 CDS 100% 3.000 2.100 N CAP1 n/a
8 TRCN0000278323 GCAGTTCAAGACCCTATGGAA pLKO_005 1576 CDS 100% 3.000 2.100 N CAP1 n/a
9 TRCN0000105887 CCATTACAGTAGATAACTGTA pLKO.1 1317 CDS 100% 0.495 0.347 N Cap1 n/a
10 TRCN0000332180 CCATTACAGTAGATAACTGTA pLKO_005 1317 CDS 100% 0.495 0.347 N Cap1 n/a
11 TRCN0000029350 GCTCCATATGTGCAGGCATTT pLKO.1 332 CDS 100% 0.000 0.000 N CAP1 n/a
12 TRCN0000278325 GCTCCATATGTGCAGGCATTT pLKO_005 332 CDS 100% 0.000 0.000 N CAP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001350483.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02454 pDONR223 100% 99.7% 99.7% None 110_111insAGC n/a
2 ccsbBroad304_02454 pLX_304 0% 99.7% 99.7% V5 110_111insAGC n/a
3 TRCN0000480284 TGAGGTAACATTATCGGCACGAAG pLX_317 24.1% 99.7% 99.7% V5 110_111insAGC n/a
Download CSV