Transcript: Human NM_001350576.2

Homo sapiens transmembrane O-mannosyltransferase targeting cadherins 4 (TMTC4), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-06-09
Taxon:
Homo sapiens (human)
Gene:
TMTC4 (84899)
Length:
3905
CDS:
260..2536

Additional Resources:

NCBI RefSeq record:
NM_001350576.2
NBCI Gene record:
TMTC4 (84899)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001350576.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151438 GCTTTATTCCTCAAGGCAATT pLKO.1 2327 CDS 100% 10.800 7.560 N TMTC4 n/a
2 TRCN0000178703 CCTGACTTTCAGGATTAACTA pLKO.1 583 CDS 100% 5.625 3.938 N Tmtc4 n/a
3 TRCN0000293095 CCTGACTTTCAGGATTAACTA pLKO_005 583 CDS 100% 5.625 3.938 N Tmtc4 n/a
4 TRCN0000152153 CTCTGACTTGTGCAATTTCAA pLKO.1 3170 3UTR 100% 5.625 3.938 N TMTC4 n/a
5 TRCN0000151358 GCTAAGGTTCACTACAACATT pLKO.1 1754 CDS 100% 5.625 3.938 N TMTC4 n/a
6 TRCN0000152346 CACCAGCAATATACTCTTGAA pLKO.1 2688 3UTR 100% 4.950 3.465 N TMTC4 n/a
7 TRCN0000152485 CCTGAGCAAACATACCAAGAA pLKO.1 1603 CDS 100% 4.950 3.465 N TMTC4 n/a
8 TRCN0000153751 CGTCTGTATGCAGATCTCAAT pLKO.1 2084 CDS 100% 4.950 3.465 N TMTC4 n/a
9 TRCN0000151284 CTGAGAAGAAAGCTAGAACTA pLKO.1 2495 CDS 100% 4.950 3.465 N TMTC4 n/a
10 TRCN0000151611 GCTGGGAATCTTATTCATCAA pLKO.1 1648 CDS 100% 4.950 3.465 N TMTC4 n/a
11 TRCN0000151556 GCAATTTCAATACACAGGAGA pLKO.1 3181 3UTR 100% 2.640 1.848 N TMTC4 n/a
12 TRCN0000198290 GCTAAGTTAGTAGTGGGATTT pLKO.1 380 CDS 100% 10.800 15.120 N Tmtc4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001350576.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14318 pDONR223 100% 50.8% 48.1% None (many diffs) n/a
2 ccsbBroad304_14318 pLX_304 0% 50.8% 48.1% V5 (many diffs) n/a
3 TRCN0000478510 TTTTGAGCACGAAAAGTAATTTTG pLX_317 25.8% 50.8% 48.1% V5 (many diffs) n/a
Download CSV