Construct: ORF TRCN0000478510
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003588.2_s317c1
- Derived from:
- ccsbBroadEn_14318
- DNA Barcode:
- TTTTGAGCACGAAAAGTAATTTTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TMTC4 (84899)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478510
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 84899 | TMTC4 | transmembrane O-mannosyltra... | XM_017020798.1 | 73.9% | 69.5% | (many diffs) |
2 | human | 84899 | TMTC4 | transmembrane O-mannosyltra... | XM_017020799.2 | 73.9% | 69.5% | (many diffs) |
3 | human | 84899 | TMTC4 | transmembrane O-mannosyltra... | XM_017020797.2 | 66.6% | 62.7% | (many diffs) |
4 | human | 84899 | TMTC4 | transmembrane O-mannosyltra... | NM_001286453.3 | 61.5% | 58.1% | (many diffs) |
5 | human | 84899 | TMTC4 | transmembrane O-mannosyltra... | XM_011521125.1 | 55.2% | 54.9% | (many diffs) |
6 | human | 84899 | TMTC4 | transmembrane O-mannosyltra... | NM_001079669.4 | 52.3% | 49.6% | (many diffs) |
7 | human | 84899 | TMTC4 | transmembrane O-mannosyltra... | NM_001350572.2 | 52.3% | 49.6% | (many diffs) |
8 | human | 84899 | TMTC4 | transmembrane O-mannosyltra... | NM_001350577.2 | 52.1% | 49.3% | (many diffs) |
9 | human | 84899 | TMTC4 | transmembrane O-mannosyltra... | NM_032813.5 | 51% | 48.3% | (many diffs) |
10 | human | 84899 | TMTC4 | transmembrane O-mannosyltra... | NM_001350576.2 | 50.8% | 48.1% | (many diffs) |
11 | human | 84899 | TMTC4 | transmembrane O-mannosyltra... | NM_001350574.2 | 48.5% | 46% | (many diffs) |
12 | human | 84899 | TMTC4 | transmembrane O-mannosyltra... | XM_011521123.2 | 48.5% | 46% | (many diffs) |
13 | human | 84899 | TMTC4 | transmembrane O-mannosyltra... | NM_001350571.2 | 47.4% | 45% | (many diffs) |
14 | human | 84899 | TMTC4 | transmembrane O-mannosyltra... | XM_011521122.3 | 47.4% | 45% | (many diffs) |
15 | human | 84899 | TMTC4 | transmembrane O-mannosyltra... | NR_146794.2 | 30.5% | (many diffs) | |
16 | human | 84899 | TMTC4 | transmembrane O-mannosyltra... | XM_017020800.1 | 24.2% | 23.6% | (many diffs) |
17 | mouse | 70551 | Tmtc4 | transmembrane and tetratric... | XM_017316184.1 | 64.4% | 62.8% | (many diffs) |
18 | mouse | 70551 | Tmtc4 | transmembrane and tetratric... | XM_017316185.1 | 57.3% | 56.1% | (many diffs) |
19 | mouse | 70551 | Tmtc4 | transmembrane and tetratric... | XM_017316183.1 | 54.4% | 53.2% | (many diffs) |
20 | mouse | 70551 | Tmtc4 | transmembrane and tetratric... | XM_006519511.3 | 45.7% | 44.9% | (many diffs) |
21 | mouse | 70551 | Tmtc4 | transmembrane and tetratric... | XM_017316182.1 | 45.7% | 44.9% | (many diffs) |
22 | mouse | 70551 | Tmtc4 | transmembrane and tetratric... | NM_028651.2 | 45.6% | 44.8% | (many diffs) |
23 | mouse | 70551 | Tmtc4 | transmembrane and tetratric... | XM_006519509.3 | 45.6% | 44.8% | (many diffs) |
24 | mouse | 70551 | Tmtc4 | transmembrane and tetratric... | XM_006519510.3 | 45.6% | 44.8% | (many diffs) |
25 | mouse | 70551 | Tmtc4 | transmembrane and tetratric... | XM_006519512.1 | 45.6% | 44.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1251
- ORF length:
- 1185
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgct gtgcaaagan caagggatca ctgtgctggg tttaaatgcg gtatttgaca 121 tcttggtgat aggcaaattc aatgttctgg aaattgtcca gaaggtacta cataaggaca 181 agtcattaga gaatctcggc atgctcagga acgggggcct cctcttcaga atgaccctgc 241 tcacctctgg aggggctggg atgctctacg tgcgctggag gatcatgggc acgggcccgc 301 cggccttcac cgaggtggac aacccggcct cctttgctga cagcatgctg gtgagggccg 361 taaactacaa ttactactat tcattgaatg cctggctgct gctgtgtccc tggtggctgt 421 gttttgattg gtcaatgggc tgcatccccc tcattaagtc catcagcgac tggagggtaa 481 ttgcacttgc agcactctgg ttctgcctaa ttggcctgat atgccaagcc ctgtgctctg 541 aagacggcca caagagaagg atccttactc tgggcctggg atttctcgtt atcccatttc 601 tccccgcgag taacctgttc ttccgagtgg gcttcgtggt cgcggagcgt gtcctctacc 661 tccccagcgt tgggtactgt gtgctgctga cttttggatt cggagccctg agcaaacata 721 ccaagaaaaa gaaactcatt gccgctgtcg tgctgggaat cttattcatc aacacgctga 781 gatgtgtgct gcgcagcggc gagtggcgga gtgaggaaca gcttttcaga agtgctctgt 841 ctgtgtgtcc cctcaatgct aaggttcact acaacattgg caaaaacctg gctgataaag 901 gcaaccagac agctgccatc agatactacc gggaagctgt aagattaaat CCCAAGTATG 961 TTCATGCCAT GAATAATCTT GGAAATATCT TAAAAGAAAG GAATGAGCTA CAGGAAGCTG 1021 AGGAGCTGCT GTCTTTGGCT GTTCAAATAC AGCCAGACTT TGCCGCTGCG TGGATGAATC 1081 TAGGCATAGT GCAGAATAGC CTGAAACGGT TTGAAGCAGC AGAGCAAAGT TACCGGACAG 1141 CAATTAAACA CAGAAGGAAA TACCCAGACT GTTACTACAA CCTCGGGCGT CTGGTAAGCG 1201 CGGGGTGCCC TGTGCCTGTG GAAGGAAAGA TGGGTTATTT TTCTTATTTA TACCCAACTT 1261 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1321 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1381 CTTGTGGAAA GGACGATTTT GAGCACGAAA AGTAATTTTG ACGCGTTAAG TCgacaatca 1441 acctctggat tacaaaattt gtgaaagatt