Transcript: Human NM_001350618.1

Homo sapiens coiled-coil domain containing 122 (CCDC122), transcript variant 3, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
CCDC122 (160857)
Length:
1769
CDS:
368..826

Additional Resources:

NCBI RefSeq record:
NM_001350618.1
NBCI Gene record:
CCDC122 (160857)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001350618.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434014 CAAGAGTCTCTGTGACTATTT pLKO_005 1062 3UTR 100% 13.200 9.240 N CCDC122 n/a
2 TRCN0000413172 GTAGAGAGCAAATGGTCATTT pLKO_005 428 CDS 100% 13.200 9.240 N CCDC122 n/a
3 TRCN0000420800 CATAAGAGGTATGATGCAATT pLKO_005 683 CDS 100% 10.800 7.560 N CCDC122 n/a
4 TRCN0000413255 TGGAATGCAAGAGTAACATTG pLKO_005 811 CDS 100% 10.800 7.560 N CCDC122 n/a
5 TRCN0000129871 GCCATAGAGAATACCAAACTT pLKO.1 248 5UTR 100% 5.625 3.938 N CCDC122 n/a
6 TRCN0000128423 GAACCGAATAACACAAGTACA pLKO.1 538 CDS 100% 4.950 3.465 N CCDC122 n/a
7 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1495 3UTR 100% 5.625 2.813 Y KLHL30 n/a
8 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1495 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001350618.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13319 pDONR223 100% 42.8% 35.8% None (many diffs) n/a
2 ccsbBroad304_13319 pLX_304 0% 42.8% 35.8% V5 (many diffs) n/a
3 TRCN0000481634 CATCTTTTTGTAATCCGGTCTCTT pLX_317 64.3% 42.8% 35.8% V5 (many diffs) n/a
Download CSV