Transcript: Human NM_001350913.2

Homo sapiens pyridine nucleotide-disulphide oxidoreductase domain 1 (PYROXD1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
PYROXD1 (79912)
Length:
4001
CDS:
780..1505

Additional Resources:

NCBI RefSeq record:
NM_001350913.2
NBCI Gene record:
PYROXD1 (79912)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001350913.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064318 CCCAACATTAAGGTTATAGAA pLKO.1 308 5UTR 100% 5.625 7.875 N PYROXD1 n/a
2 TRCN0000064321 GCGATTTCATTGTCAGTGCTA pLKO.1 931 CDS 100% 2.640 3.696 N PYROXD1 n/a
3 TRCN0000424713 GAAGTGATTTGGGCCATTAAA pLKO_005 510 5UTR 100% 15.000 10.500 N PYROXD1 n/a
4 TRCN0000416872 TAGGTTCAGATCATGAATTAA pLKO_005 1291 CDS 100% 15.000 10.500 N PYROXD1 n/a
5 TRCN0000432361 TAATTGGTGAAACCGATTTAG pLKO_005 1384 CDS 100% 13.200 9.240 N PYROXD1 n/a
6 TRCN0000064320 CCAGATATACAACTGAAGGAA pLKO.1 634 5UTR 100% 3.000 2.100 N PYROXD1 n/a
7 TRCN0000064322 GCTACTCACTTTCCATCGGAA pLKO.1 164 5UTR 100% 2.640 1.848 N PYROXD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001350913.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04147 pDONR223 100% 48.2% 48.2% None 0_1ins777 n/a
2 ccsbBroad304_04147 pLX_304 0% 48.2% 48.2% V5 0_1ins777 n/a
3 TRCN0000472946 CTCATCCCTGCACTGGGAGCTTCC pLX_317 26.3% 48.2% 48.2% V5 0_1ins777 n/a
Download CSV