Transcript: Human NM_001350925.1

Homo sapiens cytochrome c oxidase assembly factor 1 homolog (COA1), transcript variant 17, mRNA.

Source:
NCBI, updated 2019-07-09
Taxon:
Homo sapiens (human)
Gene:
COA1 (55744)
Length:
981
CDS:
206..646

Additional Resources:

NCBI RefSeq record:
NM_001350925.1
NBCI Gene record:
COA1 (55744)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001350925.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000145132 GCCATTGTGTATTACCTCATT pLKO.1 296 CDS 100% 4.950 6.930 N COA1 n/a
2 TRCN0000144831 GTTGATGCCAAGTTGAAGATT pLKO.1 458 CDS 100% 5.625 3.938 N COA1 n/a
3 TRCN0000143935 CCAGGGCTTTATATTACAAGT pLKO.1 330 CDS 100% 4.950 3.465 N COA1 n/a
4 TRCN0000140758 GTCAGCAGATTCCTGTGTTCA pLKO.1 585 CDS 100% 4.950 3.465 N COA1 n/a
5 TRCN0000140634 GCAGATTCCTGTGTTCAAGCT pLKO.1 589 CDS 100% 2.640 1.848 N COA1 n/a
6 TRCN0000438319 CTCTGGGAGCAAGGATCCTTT pLKO_005 246 CDS 100% 4.950 2.970 N COA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001350925.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03646 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03646 pLX_304 0% 100% 100% V5 n/a
Download CSV