Transcript: Human NM_001350985.2

Homo sapiens zinc finger and SCAN domain containing 25 (ZSCAN25), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
ZSCAN25 (221785)
Length:
4370
CDS:
118..978

Additional Resources:

NCBI RefSeq record:
NM_001350985.2
NBCI Gene record:
ZSCAN25 (221785)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001350985.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107693 GTTGGGTATTCCTGTGGTGAA pLKO.1 162 CDS 100% 4.050 5.670 N ZSCAN25 n/a
2 TRCN0000244960 AGATGGCAGCTGGGTTCTTTA pLKO_005 764 CDS 100% 13.200 9.240 N ZSCAN25 n/a
3 TRCN0000107692 CCAGCCCAGATAGACTGCTTT pLKO.1 862 CDS 100% 4.950 3.465 N ZSCAN25 n/a
4 TRCN0000244959 CTCAGCAGCAGTTGGGTATTC pLKO_005 152 CDS 100% 10.800 6.480 N ZSCAN25 n/a
5 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4135 3UTR 100% 5.625 2.813 Y KLHL30 n/a
6 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4135 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001350985.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14441 pDONR223 100% 49.2% 43.6% None (many diffs) n/a
Download CSV