Transcript: Human NM_001351050.2

Homo sapiens syntaxin 2 (STX2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
STX2 (2054)
Length:
1072
CDS:
152..961

Additional Resources:

NCBI RefSeq record:
NM_001351050.2
NBCI Gene record:
STX2 (2054)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001351050.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000065283 CGAGCCAAGTTAAAGGCTATT pLKO.1 416 CDS 100% 10.800 15.120 N STX2 n/a
2 TRCN0000065287 GCATGAGATGTTCATGGACAT pLKO.1 784 CDS 100% 0.405 0.324 N STX2 n/a
3 TRCN0000065286 CCATCTTCACTTCCGACATTA pLKO.1 672 CDS 100% 13.200 9.240 N STX2 n/a
4 TRCN0000065285 GCGTGTAGGAAGAATGATGAT pLKO.1 179 CDS 100% 4.950 3.465 N STX2 n/a
5 TRCN0000382503 GACTATGTAGAACACGCTAAA pLKO_005 872 CDS 100% 10.800 6.480 N STX2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001351050.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06171 pDONR223 100% 93.1% 90% None (many diffs) n/a
2 ccsbBroad304_06171 pLX_304 0% 93.1% 90% V5 (many diffs) n/a
3 TRCN0000477807 CTCTGATGCGGCGTACGATCGGCC pLX_317 51.8% 93.1% 90% V5 (many diffs) n/a
Download CSV