Transcript: Human NM_001351148.1

Homo sapiens thymocyte expressed, positive selection associated 1 (TESPA1), transcript variant 5, mRNA.

Source:
NCBI, updated 2018-11-25
Taxon:
Homo sapiens (human)
Gene:
TESPA1 (9840)
Length:
3826
CDS:
586..1737

Additional Resources:

NCBI RefSeq record:
NM_001351148.1
NBCI Gene record:
TESPA1 (9840)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001351148.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000283738 CCAGGTGCGGAGGATTGAAAT pLKO_005 780 CDS 100% 13.200 18.480 N TESPA1 n/a
2 TRCN0000268589 CCAGAACTGCGTCGGTCTTTA pLKO_005 1582 CDS 100% 13.200 9.240 N TESPA1 n/a
3 TRCN0000268527 GCATGTGGTCTGACAGAATTG pLKO_005 1760 3UTR 100% 10.800 7.560 N TESPA1 n/a
4 TRCN0000268588 TGTTGGAAGTGATGGACAAAG pLKO_005 1118 CDS 100% 10.800 7.560 N TESPA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001351148.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11421 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_11421 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467039 TTGTCCAAACTAATCCGTTCCGGA pLX_317 23.9% 100% 100% V5 n/a
4 ccsbBroadEn_11422 pDONR223 100% 96.7% 96.4% None (many diffs) n/a
Download CSV