Transcript: Human NM_001351232.2

Homo sapiens RIMS binding protein 2 (RIMBP2), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
RIMBP2 (23504)
Length:
3395
CDS:
468..2729

Additional Resources:

NCBI RefSeq record:
NM_001351232.2
NBCI Gene record:
RIMBP2 (23504)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001351232.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154932 GCTCTGCGATCGGTGAATATA pLKO.1 850 CDS 100% 15.000 21.000 N RIMBP2 n/a
2 TRCN0000154201 CAATACCTCCAAGCAGAGATA pLKO.1 992 CDS 100% 4.950 3.465 N RIMBP2 n/a
3 TRCN0000152408 CCTGCTACAAGAGATGACTTT pLKO.1 3189 3UTR 100% 4.950 3.465 N RIMBP2 n/a
4 TRCN0000154907 GACTTCCTGAAAGGCTCTGAA pLKO.1 2688 CDS 100% 4.950 3.465 N RIMBP2 n/a
5 TRCN0000152892 GCAGGATCAGAACTTCATCAA pLKO.1 1256 CDS 100% 4.950 3.465 N RIMBP2 n/a
6 TRCN0000153217 GACATGGAGAATGAACGGAAT pLKO.1 969 CDS 100% 4.050 2.835 N RIMBP2 n/a
7 TRCN0000154232 CCCAATCAAAGCCATTAGCAA pLKO.1 2308 CDS 100% 3.000 2.100 N RIMBP2 n/a
8 TRCN0000155646 CAGATTACAAACCCGGAGGAA pLKO.1 2899 3UTR 100% 2.640 1.848 N RIMBP2 n/a
9 TRCN0000154407 GCCATTAGCAAGTTCTGGAGT pLKO.1 2318 CDS 100% 2.640 1.584 N RIMBP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001351232.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14088 pDONR223 100% 85.1% 85% None (many diffs) n/a
2 ccsbBroad304_14088 pLX_304 0% 85.1% 85% V5 (many diffs) n/a
3 TRCN0000468922 CGGGAAACCACGCAAATTTAATTC pLX_317 15.6% 85.1% 85% V5 (many diffs) n/a
Download CSV