Transcript: Human NM_001351371.2

Homo sapiens YEATS domain containing 2 (YEATS2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
YEATS2 (55689)
Length:
3688
CDS:
217..3318

Additional Resources:

NCBI RefSeq record:
NM_001351371.2
NBCI Gene record:
YEATS2 (55689)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001351371.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140296 GCGAGCTACGAACAATGCTAA pLKO.1 2565 CDS 100% 4.950 6.930 N YEATS2 n/a
2 TRCN0000140478 GCAAGTTGTAACCCAAGGAGT pLKO.1 2286 CDS 100% 2.640 3.696 N YEATS2 n/a
3 TRCN0000417949 TCATTGACCAGCGACTGATTG pLKO_005 404 CDS 100% 10.800 8.640 N YEATS2 n/a
4 TRCN0000219064 TTCCTTCATCCTAGCTATAAA pLKO_005 985 CDS 100% 15.000 10.500 N Yeats2 n/a
5 TRCN0000431997 ATAACAGCAATATGGATATAG pLKO_005 680 CDS 100% 13.200 9.240 N YEATS2 n/a
6 TRCN0000144252 CGTCAGAGTTCAAGTTCATTT pLKO.1 1074 CDS 100% 13.200 9.240 N YEATS2 n/a
7 TRCN0000219117 ACAAGCGGATAGATATCATAC pLKO_005 1109 CDS 100% 10.800 7.560 N Yeats2 n/a
8 TRCN0000432505 AGTACAGGAAGTCCTACAAAC pLKO_005 1762 CDS 100% 10.800 7.560 N YEATS2 n/a
9 TRCN0000427271 ATTTGCCTCCTGGCACTAAAC pLKO_005 2471 CDS 100% 10.800 7.560 N YEATS2 n/a
10 TRCN0000144134 CCTAACTACAAACAGCAAGAA pLKO.1 2496 CDS 100% 4.950 3.465 N YEATS2 n/a
11 TRCN0000140368 GCCGAAATACTGGAAGGGATA pLKO.1 737 CDS 100% 4.050 2.835 N YEATS2 n/a
12 TRCN0000139940 GCTGCAAGATTGTGTCAGGTT pLKO.1 1589 CDS 100% 2.640 1.848 N YEATS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001351371.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08565 pDONR223 100% 72.5% 72.4% None (many diffs) n/a
2 ccsbBroad304_08565 pLX_304 0% 72.5% 72.4% V5 (many diffs) n/a
Download CSV