Transcript: Human NM_001351431.1

Homo sapiens AU RNA binding methylglutaconyl-CoA hydratase (AUH), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
AUH (549)
Length:
1716
CDS:
478..1170

Additional Resources:

NCBI RefSeq record:
NM_001351431.1
NBCI Gene record:
AUH (549)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001351431.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052450 CCCTCGCTATAAAGGAGAATA pLKO.1 1149 CDS 100% 13.200 18.480 N AUH n/a
2 TRCN0000303617 GCAATAGATGGACTCGCTTTA pLKO_005 682 CDS 100% 10.800 8.640 N AUH n/a
3 TRCN0000052451 GTCGATTTAGTAACAGGGTTA pLKO.1 1045 CDS 100% 4.050 3.240 N AUH n/a
4 TRCN0000303619 AGAGCAGTGATTAACGATATT pLKO_005 634 CDS 100% 13.200 9.240 N AUH n/a
5 TRCN0000303616 AGATTATTCATACGGTGTAAT pLKO_005 1282 3UTR 100% 13.200 9.240 N AUH n/a
6 TRCN0000303618 AGTGAAGTCCCAGGGATATTC pLKO_005 541 CDS 100% 13.200 9.240 N AUH n/a
7 TRCN0000052452 GATAAGAAAGTACGGACCATA pLKO.1 511 CDS 100% 4.950 3.465 N AUH n/a
8 TRCN0000052449 GCTTGGAATAAACAGAGCTTA pLKO.1 423 5UTR 100% 4.950 3.465 N AUH n/a
9 TRCN0000299346 GCTTGGAATAAACAGAGCTTA pLKO_005 423 5UTR 100% 4.950 3.465 N AUH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001351431.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10692 pDONR223 100% 59.2% 59.2% None 0_1ins327;90_176del n/a
2 ccsbBroad304_10692 pLX_304 0% 59.2% 59.2% V5 0_1ins327;90_176del n/a
3 TRCN0000481053 CAATGATTCCATAACCTCATAGTC pLX_317 32% 59.2% 59.2% V5 0_1ins327;90_176del n/a
Download CSV