Transcript: Human NM_001351648.2

Homo sapiens protein phosphatase 6 regulatory subunit 2 (PPP6R2), transcript variant 12, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
PPP6R2 (9701)
Length:
3967
CDS:
812..3124

Additional Resources:

NCBI RefSeq record:
NM_001351648.2
NBCI Gene record:
PPP6R2 (9701)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001351648.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000143209 GAACTATGCATAGCCGCTATT pLKO.1 1499 CDS 100% 10.800 15.120 N PPP6R2 n/a
2 TRCN0000139866 GACCAGGACGACAACATCAAT pLKO.1 2006 CDS 100% 5.625 7.875 N PPP6R2 n/a
3 TRCN0000144656 GCTGGACTTGTTCTTTAAGTA pLKO.1 1447 CDS 100% 5.625 7.875 N PPP6R2 n/a
4 TRCN0000139734 CTGTACGACTTCTTGGACCAT pLKO.1 641 5UTR 100% 2.640 3.696 N PPP6R2 n/a
5 TRCN0000139709 GTGTTACTCACCTTGCTGGAA pLKO.1 1136 CDS 100% 2.640 3.696 N PPP6R2 n/a
6 TRCN0000145433 GATGAAGATAGGCAGTCAAAT pLKO.1 935 CDS 100% 13.200 9.240 N PPP6R2 n/a
7 TRCN0000145052 CAGGAGTTAATGGATGAAGAT pLKO.1 444 5UTR 100% 4.950 3.465 N PPP6R2 n/a
8 TRCN0000139026 CAAGTTCATCAGCCTGGTGTT pLKO.1 766 5UTR 100% 4.050 2.835 N PPP6R2 n/a
9 TRCN0000122130 GCTGAATGAAGAGAAGGTCAT pLKO.1 880 CDS 100% 4.050 2.835 N PPP6R2 n/a
10 TRCN0000139407 GCAAGACCATTGGCAATCTCA pLKO.1 699 5UTR 100% 3.000 2.100 N PPP6R2 n/a
11 TRCN0000140903 CCAAGAAGAAAGCGATCCTGA pLKO.1 1293 CDS 100% 2.640 1.848 N PPP6R2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001351648.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07471 pDONR223 100% 82.5% 82.6% None 0_1ins486;1536G>C;2004T>G n/a
2 ccsbBroad304_07471 pLX_304 0% 82.5% 82.6% V5 0_1ins486;1536G>C;2004T>G n/a
Download CSV