Transcript: Human NM_001352365.2

Homo sapiens protein phosphatase 6 regulatory subunit 3 (PPP6R3), transcript variant 25, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
PPP6R3 (55291)
Length:
5021
CDS:
234..2804

Additional Resources:

NCBI RefSeq record:
NM_001352365.2
NBCI Gene record:
PPP6R3 (55291)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001352365.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431807 GAGACACGACGACCAACATTT pLKO_005 1062 CDS 100% 13.200 18.480 N PPP6R3 n/a
2 TRCN0000160662 CGAGTATCAGACATCAACTTT pLKO.1 1926 CDS 100% 5.625 7.875 N PPP6R3 n/a
3 TRCN0000160381 CAAGGTGCTAAGTATTCTTAT pLKO.1 608 CDS 100% 13.200 10.560 N PPP6R3 n/a
4 TRCN0000435261 AGATTCTTTAAGGAGTAATTC pLKO_005 2381 CDS 100% 13.200 9.240 N PPP6R3 n/a
5 TRCN0000160661 CCATTCAGCTTGTTCAGTAAA pLKO.1 1118 CDS 100% 13.200 9.240 N PPP6R3 n/a
6 TRCN0000159529 CGAAGATTTAGTCTCATTCAT pLKO.1 395 CDS 100% 5.625 3.938 N PPP6R3 n/a
7 TRCN0000162457 CGCAAGAAGAAGATCGACATT pLKO.1 838 CDS 100% 4.950 3.465 N PPP6R3 n/a
8 TRCN0000164498 CTTCAGTGAATGGCCCTGTAT pLKO.1 2782 CDS 100% 4.950 3.465 N PPP6R3 n/a
9 TRCN0000159679 GAGTTAATGGATGAGGAAGAT pLKO.1 309 CDS 100% 4.950 3.465 N PPP6R3 n/a
10 TRCN0000161015 GAATACTTGAAGCCTGGGAAA pLKO.1 1540 CDS 100% 4.050 2.835 N PPP6R3 n/a
11 TRCN0000161472 GCAGAAAGTACAGACAAGGTA pLKO.1 2529 CDS 100% 3.000 2.100 N PPP6R3 n/a
12 TRCN0000159973 CAAGAAATTATAGAGCAGCTT pLKO.1 966 CDS 100% 2.640 1.848 N PPP6R3 n/a
13 TRCN0000413749 CCAACTGGTCAGCTAACTTTG pLKO_005 2224 CDS 100% 10.800 6.480 N PPP6R3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001352365.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15896 pDONR223 0% 23.4% 23.4% None 1_1965del n/a
2 ccsbBroad304_15896 pLX_304 0% 23.4% 23.4% V5 1_1965del n/a
Download CSV