Transcript: Human NM_001352548.1

Homo sapiens protein tyrosine phosphatase non-receptor type 20 (PTPN20), transcript variant 48, mRNA.

Source:
NCBI, updated 2019-02-16
Taxon:
Homo sapiens (human)
Gene:
PTPN20 (26095)
Length:
2318
CDS:
461..739

Additional Resources:

NCBI RefSeq record:
NM_001352548.1
NBCI Gene record:
PTPN20 (26095)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001352548.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078566 TCTTCGGAATTTCCCACATAA pLKO.1 441 5UTR 100% 13.200 18.480 N PTPN20 n/a
2 TRCN0000078567 GTAAACGATTATGAGGGAAAT pLKO.1 304 5UTR 100% 10.800 15.120 N PTPN20 n/a
3 TRCN0000255616 GACTTTGCCTCGTACAATTAA pLKO_005 1838 3UTR 100% 15.000 12.000 N PTPN20 n/a
4 TRCN0000360289 CGATTGCAGCTTGGCTATTTG pLKO_005 997 3UTR 100% 13.200 10.560 N PTPN20 n/a
5 TRCN0000078563 CCACCCTAACACTTAACATAT pLKO.1 1472 3UTR 100% 13.200 9.240 N PTPN20 n/a
6 TRCN0000078564 CTTCGGAATTTCCCACATAAT pLKO.1 442 5UTR 100% 13.200 9.240 N PTPN20 n/a
7 TRCN0000360288 AGCTCCCTGAAGGGCAATATC pLKO_005 880 3UTR 100% 13.200 7.920 N PTPN20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001352548.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11809 pDONR223 100% 42.4% 5.9% None (many diffs) n/a
2 ccsbBroad304_11809 pLX_304 0% 42.4% 5.9% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000478274 CACCATAGGAAAGCATTCACTAGC pLX_317 63.1% 42.4% 5.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV