Transcript: Human NM_001352774.1

Homo sapiens junction plakoglobin (JUP), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
JUP (3728)
Length:
3264
CDS:
187..2424

Additional Resources:

NCBI RefSeq record:
NM_001352774.1
NBCI Gene record:
JUP (3728)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001352774.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303924 ACTCTGTGCGTCTCAACTATG pLKO_005 1607 CDS 100% 10.800 15.120 N JUP n/a
2 TRCN0000083712 GATCATGCGTAACTACAGTTA pLKO.1 1137 CDS 100% 4.950 6.930 N JUP n/a
3 TRCN0000300091 GATCATGCGTAACTACAGTTA pLKO_005 1137 CDS 100% 4.950 6.930 N JUP n/a
4 TRCN0000303925 ATCCGTGTGTCCCAGCAATAA pLKO_005 1200 CDS 100% 13.200 9.240 N JUP n/a
5 TRCN0000083711 CGAGGACAAGAACCCAGACTA pLKO.1 2145 CDS 100% 4.950 3.465 N JUP n/a
6 TRCN0000083710 GTGCTGAAGATTCTGGTGAAT pLKO.1 1360 CDS 100% 4.950 3.465 N JUP n/a
7 TRCN0000083709 GCGCCAGTACACGCTCAAGAA pLKO.1 336 CDS 100% 1.650 1.155 N JUP n/a
8 TRCN0000310551 GCGCCAGTACACGCTCAAGAA pLKO_005 336 CDS 100% 1.650 1.155 N JUP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001352774.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06466 pDONR223 100% 99.8% 99.7% None (many diffs) n/a
2 ccsbBroad304_06466 pLX_304 0% 99.8% 99.7% V5 (many diffs) n/a
3 TRCN0000479951 ATGCGCCAACTCTTATTAGATAAT pLX_317 14% 99.8% 99.7% V5 (many diffs) n/a
Download CSV