Transcript: Human NM_001353366.2

Homo sapiens nucleolar protein with MIF4G domain 1 (NOM1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
NOM1 (64434)
Length:
6085
CDS:
27..2612

Additional Resources:

NCBI RefSeq record:
NM_001353366.2
NBCI Gene record:
NOM1 (64434)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001353366.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246060 ACTAGAGGGTGCAGTTATAAA pLKO_005 3235 3UTR 100% 15.000 21.000 N NOM1 n/a
2 TRCN0000246061 CGCGACGGTCTTGACTATATT pLKO_005 663 CDS 100% 15.000 21.000 N NOM1 n/a
3 TRCN0000128373 GAAGTTCGATGCCATCTATAA pLKO.1 1370 CDS 100% 13.200 18.480 N LOC392850 n/a
4 TRCN0000246063 GACGGTGACATAACGGATAAG pLKO_005 993 CDS 100% 10.800 15.120 N NOM1 n/a
5 TRCN0000246062 CACCGTCATTGCCCATTTATA pLKO_005 1427 CDS 100% 15.000 12.000 N NOM1 n/a
6 TRCN0000257483 CCAGACCAGGATTCGGTTTAT pLKO_005 1652 CDS 100% 13.200 9.240 N NOM1 n/a
7 TRCN0000130523 GCCAGCTACGAATTTCTCTAA pLKO.1 2246 CDS 100% 4.950 3.465 N LOC392850 n/a
8 TRCN0000130343 GCTGGTGTGTATGATTGTCTT pLKO.1 2875 3UTR 100% 4.950 3.465 N LOC392850 n/a
9 TRCN0000130330 GAAAGAGTGTGACAACCTGTT pLKO.1 1406 CDS 100% 4.050 2.835 N LOC392850 n/a
10 TRCN0000129265 CAGTTCAGCATATGGGACAAA pLKO.1 2205 CDS 100% 0.000 0.000 N LOC392850 n/a
11 TRCN0000128860 GCATGTTCTCTTAGTCAGCAT pLKO.1 1292 CDS 100% 2.640 1.584 N LOC392850 n/a
12 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 5479 3UTR 100% 4.950 2.475 Y ERAP2 n/a
13 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 5515 3UTR 100% 4.050 2.025 Y P3H4 n/a
14 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 5515 3UTR 100% 4.050 2.025 Y ORAI2 n/a
15 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 5515 3UTR 100% 4.050 2.025 Y P3H4 n/a
16 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 5480 3UTR 100% 13.200 6.600 Y LIAS n/a
17 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3570 3UTR 100% 5.625 2.813 Y KLHL30 n/a
18 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 5643 3UTR 100% 4.950 2.475 Y DCAF11 n/a
19 TRCN0000172742 GAGACAGAGTCTTGCTCTGTT pLKO.1 3334 3UTR 100% 0.495 0.248 Y C11orf44 n/a
20 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3570 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001353366.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.